How to Read Fasta Files on Mac
More detailed assistance pages are available at http://www.blaststation.com/aid/bs2/en/mac/index.html
or Launch BlastStation and goto Assistance > BlastStation Help Menu.
EBI (European Bioinformatics Institute) appear WU-Blast will exist retired from service in August 2015.
Due to this, EBI:WU-Blast2 search in BlastStation2 volition not office from September 2015. Delight use EBI:NCBI-Blast search, instead.
i. Launch BlastStation2 and enter FASTA data
Double click BlastStation2 icon, which is in the Applications folder. You can elevate and drop to add it to the dock for like shooting fish in a barrel access later.
The BlastStation2 main window will be shown.
 |
Copy and paste FASTA information below in the Input Data.
- >gi|11611818|gb|AF287139.1|AF287139 Latimeria chalumnae Hoxa-11 gene, partial cds
TACTTGCCAAGTTGCACCTACTACGTTTCGGGTCCCGATTTCTCCAGCCTCCCTTCTTTTTTGCCCCAGA
CCCCGTCTTCTCGCCCCATGACATACTCCTATTCGTCTAATCTACCCCAAGTTCAACCTGTGAGAGAAGT
TACCTTCAGGGACTATGCCATTGATACATCCAATAAATGGCATCCCAGAAGCAATTTACCCCATTGCTAC
TCAACAGAGGAGATTCTGCACAGGGACTGCCTAGCAACCACCACCGCTTCAAGCATAGGAGAAATCTTTG
GGAAAGGCAACGCTAACGTCTACCATCCTGGCTCCAGCACCTCTTCTAATTTCTATAACACAGTGGGTAG
AAACGGGGTCCTACCGCAAGCCTTTGACCAGTTTTTCGAGACGGCTTATGGCACAACAGAAAACCACTCT
TCTGACTACTCTGCAGACAAGAATTCCGACAAAATACCTTCGGCAGCAACTTCAAGGTCGGAGACTTGCA
GGGAGACAGACGAGAAGGAGAGACGGGAAGAAAGCAGTAGCCCAGAGTCTTCTTCCGGCAACAATGAGGA
GAAATCAAGCAGTTCCAGTGGTCAACGTACAAGGAAGAAGAGGTGC
>gi|40789109|gb|AC147788.1| Latimeria menadoensis clone VMRC4-19C10, complete sequence
GAATTCTCGGTCGCTTCTGATCTTCAGTGAAAACTATAAAAGAAAATATAAAAGCAAGCAAGCTACAGAG
TCAGCATAATGCTATAAAACGTAAGGTGAATGAGAAGCAAATGGAAGACAACTAAGAAGATAAACTGTTA
AAGGCCATAAAGTGTACTCGGATAATTTATATATATATATATATTAGAATCACTGAAGAAAACAGCACCT
AGGTGTGTGTTTCGAAAGATGAAATCTACATTTTACGATATTGCTTTCTCCAATGTAAAAGAAGAAACGT
AAATTCCAACAGTATTTAACGCAGAATATATTTTTTCTAACGGTAACACATTAATTTTTTTTTACCCTTT
TCTGGTAGCTTTTTTATTGTTTTAAATTACTACAATCACAATACATTTTAGAGTGATATAAATATGTAAA
ACTAATATACTGTATATATTACTCGTATTGTGTTCTTAGGTCTCAGTATTTTACCTGTGGTGGTGACTGC
TTATCTGTTCAAGGTCACAGAGATATTTATTAAATCATGTTATTTTCGGTTGACTCAGTAAAAGTATAGT
TTGAGTAACAAAAAAGTATCGTGGTTTTGAGATCCTTACTTGGGAAAGGAAGCTAATACATAATTTGCTA
AACTGAGTTTAGGGACAGGTTTATAACTAAAAATGTGAACTACTTCAAATTACCATCATCTACCACATTG
AACGTATTCTTATTATGCATTGAAAATCAATGAATTCGATTACATAAATATACCATAGACTGTTGCATGA
GCAACAGTGGTTCATAGTATTTCTTATTTCTTCATTCAATTGAAGTTTTTGTCATACAGTTTTATTCTAA
CCAAATGATTAATTACTATATATGTGCTGAAAATATAAACATGATTTTCAGTGTATAGGTTGTTAGACCT
CCAGAATGAAAACACAGTTTAGAAACTTGTTTACCTTGCATACAATGTATGTCATTTTTTCTGTATAATT
AAGTTTTGGCATTTGACTTAATGTAATAAATAAGTCGTATATTTAATAATTAAATAATTTCTAATAATCT
GTACTGCTTTTCGATATCTACGTTTTTGAGTAAACTGTTTTCCTCATAAATTCAAAACAAATAAAAAAAG
AGAAATGAAAAAAAAATATTTTCATAACTTGTACTCATTTGCTGAACCAGGTCTTCCCAGGGCTCTTTCG
Just blastn, blastx and tblastx are available in the Program department.
This is because the FASTA data are DNA sequences. If the data are protein sequences, blastp and tblastn volition be available.
If you have a FASTA file on your Mac, you can likewise elevate and drib information technology to the Input Data area.
2. Select BLAST Machine
BlastStation tin can perform Smash searches on EBI remote servers, either EBI:NCBI-Blast or EBI:WU-Blast2, or local personal reckoner.
If you lot are going to perform Nail searches on your local personal computer, you lot need to download databases from the NCBI ftp server or create databases locally.
2.1 Download database
On the Tools menu, click Download DB. The DB Download window opens. DB Blazon column indicates that the database file is in DNA or Protein database format. For example env_nr.tar.gz is used for blastp and env_nt.tar.gz is used for blastn.
Click database file to highlight and and then click "Download" button to download information technology. If you want to abolish download, click "Cancel" button during downloading. When download is finished, database file will be automatically extracted and placed in the database directory and ready for local BLAST searches.
2.2 Create database
On the Tools carte du jour, click Create DB. The Create DB window opens.
Clicking "Select Input File" button will open File Open dialog. Select multi-FASTA file or FASTQ file and click "Open" button. Apparently, .gz, .Z, and .zip text files are accustomed. Selected file proper noun is shown in the "DB Name" field. Change it if necessary.
Or drag and drib input file.
Clicking "Create DB" button creates database. When database is created, "Database is created" message will be shown.
3. Submit Nail task
Only click blue "submit" push. The post-obit dialog volition exist shown.
Click "Yep".
Enter file name and click "Save". This file proper noun will exist the Smash search job name.
That's it! Now Boom search is started. The condition bar is showing "Searching...".
4. Examine Boom results
When BLAST search is finished, the following dialog will be displayed.
Click "Aye" to run into search results.
Bar graph is shown on the upper half. The color of the bar is classified past the identity. Red is 100%, regal is 90% or more, and so on. The length of the query sequence (606 in this example) is given above the black bar at the superlative. You can hands understand which portion of the subject field sequence matches with the query sequence. Move your mouse cursor on the bars. The color of the bar changes and four numbers will be displayed every bit shown below. The sequence from 19 to 572 of query sequence match with that from ii to 552 of AY661748.
Table is shown on the lower half, which consists of ID, Accession number, Definition, length, flake score, E Value, and Identity.
In guild to display the other search results, click arrows beneath.
When yous click "Leap" button, the drawer will be shown next to the window. Description of each FASTA file will be listed in this drawer. Clicking each clarification will brandish corresponding search result. If y'all have many descriptions, type in search strings in the text field and hitting enter to narrow this listing. Clicking "Jump" button again will hibernate the drawer.
Task > Display Alignment carte du jour will open Alignment window. The detailed alignment data will be displayed when the bar graph in the Results pane is clicked.
Job > Display Results bill of fare will display Smash results file in the default browser.
5. Consign Boom results and read information technology by Excel.
Search results can exist exported as an Excel readable CSV file from File > Consign bill of fare. There are "All Results" and "All All-time Hits" options.
6. Export FASTA data
You can export FASTA information of search results. Bank check cheque boxes of sequences to be exported. "Select All" will cheque all sequences. "Select All" once more will uncheck all sequences.
After checking sequences to be exported, click File > Export FASTA carte du jour. The window below will be shown.
This FASTA data volition exist saved in the file by clicking "Save".
Copyright © 2005 - 2011 TM Software, Inc. All rights reserved.
Source: https://www.blaststation.com/tutorial/bs2/en/mac/index.html
0 Response to "How to Read Fasta Files on Mac"
Post a Comment